Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-6349 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6349 Accession Number: MIMAT0025092 Mature Sequence: UGGAAUGUGGGAGGGGCAUGCG mmu-miR-6349 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-6349 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-6349 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

MIR611 Human MicroRNA Expression Plasmid (MI0003624)
SC400588 10 µg

MIR611 Human MicroRNA Expression Plasmid (MI0003624)

Sign In for Pricing
View Details
NUP37 Recombinant Protein (Rat)
RP214859 100 µg

NUP37 Recombinant Protein (Rat)

Sign In for Pricing
View Details
UBA7 (Ubiquitin-like Modifier-activating Enzyme 7, Ubiquitin-activating Enzyme 7, D8, Ubiquitin-activating Enzyme E1 Homolog, UBE1L, UBE2, UBA1B)
134984 50 µg

UBA7 (Ubiquitin-like Modifier-activating Enzyme 7, Ubiquitin-activating Enzyme 7, D8, Ubiquitin-activating Enzyme E1 Homolog, UBE1L, UBE2, UBA1B)

Sign In for Pricing
View Details
CPB2, ID (E134) (Carboxypeptidase B2, Carboxypeptidase U, CPU, Thrombin-activable Fibrinolysis Inhibitor, TAFI, Plasma Carboxypeptidase B, pCPB) (AP) discontinued
C1205-02C-AP 200 µL

CPB2, ID (E134) (Carboxypeptidase B2, Carboxypeptidase U, CPU, Thrombin-activable Fibrinolysis Inhibitor, TAFI, Plasma Carboxypeptidase B, pCPB) (AP) discontinued

Sign In for Pricing
View Details
FITC-Linked Monoclonal Antibody to Tryptase (TPS)
MBS2114496-01 0.1 mL

FITC-Linked Monoclonal Antibody to Tryptase (TPS)

Sign In for Pricing
View Details
FITC-Linked Monoclonal Antibody to Tryptase (TPS)
MBS2114496-02 0.2 mL

FITC-Linked Monoclonal Antibody to Tryptase (TPS)

Sign In for Pricing
View Details