Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-466f miRNA Agomir/Antagomir

MicroRNA: mmu-miR-466f Accession Number: MIMAT0005844 Mature Sequence: ACGUGUGUGUGCAUGUGCAUGU mmu-miR-466f are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-466f in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-466f miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Chpf sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7284905 3x 1.0 µg

Chpf sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

Sign In for Pricing
View Details
LINGO2 Rabbit Polyclonal Antibody (Carrier-free)
orb3094401 100 µg

LINGO2 Rabbit Polyclonal Antibody (Carrier-free)

Sign In for Pricing
View Details
Rgn Antibody
orb356391-01 50 µg

Rgn Antibody

Sign In for Pricing
View Details
Rgn Antibody
orb356391-02 100 µg

Rgn Antibody

Sign In for Pricing
View Details
Interleukin 22 (IL-22)
216697 100 µg

Interleukin 22 (IL-22)

Sign In for Pricing
View Details
PRKAB1 Antibody (Phospho-Ser182)
OASG00376-100UL 100 µL

PRKAB1 Antibody (Phospho-Ser182)

Sign In for Pricing
View Details