Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-6343 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6343 Accession Number: MIMAT0025086 Mature Sequence: UGUAAAGUAGGAGCUGACUGAC mmu-miR-6343 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-6343 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-6343 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

CD2 Mouse Monoclonal Antibody
AMM81687-01 1 Each

CD2 Mouse Monoclonal Antibody

Sign In for Pricing
View Details
CD2 Mouse Monoclonal Antibody
AMM81687-02 50 µL

CD2 Mouse Monoclonal Antibody

Sign In for Pricing
View Details
CD2 Mouse Monoclonal Antibody
AMM81687-03 100 µL

CD2 Mouse Monoclonal Antibody

Sign In for Pricing
View Details
Olfr1158 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4300404 1.0 µg DNA

Olfr1158 sgRNA CRISPR Lentivector (Mouse) (Target 3)

Sign In for Pricing
View Details
Rat IL1b ELISA kit
55R-1944 96 tests

Rat IL1b ELISA kit

Sign In for Pricing
View Details
SNORD116-21 ORF Vector (Human) (pORF)
44792011 1.0 µg DNA

SNORD116-21 ORF Vector (Human) (pORF)

Sign In for Pricing
View Details