Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-6340 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6340 Accession Number: MIMAT0025083 Mature Sequence: GUCAGCAGCAGCUUCGCUUUGGC mmu-miR-6340 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-6340 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-6340 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rat Hspa1l ELISA Kit
ELI-42679r 96 Tests

Rat Hspa1l ELISA Kit

Sign In for Pricing
View Details
CPA1 Recombinant Protein (Rat)
RP196058 100 µg

CPA1 Recombinant Protein (Rat)

Sign In for Pricing
View Details
Bovine Stem Cell Factor (SCF) ELISA Kit
RDR-SCF-b-96Tests 96 Tests

Bovine Stem Cell Factor (SCF) ELISA Kit

Sign In for Pricing
View Details
Protein Endotoxin Removal Kit
C0268S 200 Tests

Protein Endotoxin Removal Kit

Sign In for Pricing
View Details
IAV H1N1 M1 protein (A/California/04/2009) [His]
DAG2306 100 µg

IAV H1N1 M1 protein (A/California/04/2009) [His]

Sign In for Pricing
View Details
Rabbit Polyclonal PARC Antibody [mFluor Violet 450 SE]
NBP1-77222MFV450 0.1 mL

Rabbit Polyclonal PARC Antibody [mFluor Violet 450 SE]

Sign In for Pricing
View Details