Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-6340 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6340 Accession Number: MIMAT0025083 Mature Sequence: GUCAGCAGCAGCUUCGCUUUGGC mmu-miR-6340 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-6340 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-6340 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

3’-Deoxy-N6-isopentenyl adenosine
HY-152397 1 Each

3’-Deoxy-N6-isopentenyl adenosine

Sign In for Pricing
View Details
RNF151 Protein Vector (Mouse) (pPM-C-HA)
40261024 500 ng

RNF151 Protein Vector (Mouse) (pPM-C-HA)

Sign In for Pricing
View Details
Recombinant Human Granzyme A CF
2905-SE-010 10 µg

Recombinant Human Granzyme A CF

Sign In for Pricing
View Details
Mouse Monoclonal c-Myc Antibody (SPM237) [Alexa Fluor 750]
NBP2-86682AF750 0.1 mL

Mouse Monoclonal c-Myc Antibody (SPM237) [Alexa Fluor 750]

Sign In for Pricing
View Details
Bovine Netrin-4 (Ntn4) ELISA Kit
NSL1582Bo 96 Tests

Bovine Netrin-4 (Ntn4) ELISA Kit

Sign In for Pricing
View Details
Recombinant Swinepox virus E3 ubiquitin-protein ligase LAP (LAP), partial
MBS7059885 Inquire

Recombinant Swinepox virus E3 ubiquitin-protein ligase LAP (LAP), partial

Sign In for Pricing
View Details