Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-195b miRNA Agomir/Antagomir

MicroRNA: mmu-miR-195b Accession Number: MIMAT0025076 Mature Sequence: UAGCAGCACAGAAAUAGUAGAA mmu-miR-195b are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-195b in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-195b miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

RUNX2, phosphorylated (Ser465) (Runt-related Transcription Factor 2, Core-binding Factor Subunit alpha-1, CBF-alpha-1, Acute Myeloid Leukemia 3 Protein, Oncogene AML-3, Polyomavirus Enhancer-binding Protein 2 alpha A Subunit, PEBP2-alpha A, PEA2-alpha A, SL3-3 Enhancer Factor 1 alpha A Subunit, SL3/AKV Core-binding Factor alpha A Subunit, Osteoblast-specific Transcription Factor 2, OSF-2, AML3, CBFA1, OSF2, PEBP2A) (MaxLight 405) discontinued
R9915-10B-ML405 100 µL

RUNX2, phosphorylated (Ser465) (Runt-related Transcription Factor 2, Core-binding Factor Subunit alpha-1, CBF-alpha-1, Acute Myeloid Leukemia 3 Protein, Oncogene AML-3, Polyomavirus Enhancer-binding Protein 2 alpha A Subunit, PEBP2-alpha A, PEA2-alpha A, SL3-3 Enhancer Factor 1 alpha A Subunit, SL3/AKV Core-binding Factor alpha A Subunit, Osteoblast-specific Transcription Factor 2, OSF-2, AML3, CBFA1, OSF2, PEBP2A) (MaxLight 405) discontinued

Sign In for Pricing
View Details
Phtf2 (NM_001106577) Rat Tagged ORF Clone Lentiviral Particle
RR204555L3V 200 µL

Phtf2 (NM_001106577) Rat Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
RGD1565212 3'UTR Luciferase Stable Cell Line
TU219130 1.0 mL

RGD1565212 3'UTR Luciferase Stable Cell Line

Sign In for Pricing
View Details
C12orf50 Protein Vector (Human) (pPB-His-GST)
PV328611 500 ng

C12orf50 Protein Vector (Human) (pPB-His-GST)

Sign In for Pricing
View Details
Rabbit anti-Schizosaccharomyces pombe (strain 972/24843)(Fission yeast) aps2 Polyclonal Antibody
MBS9015506 Inquire

Rabbit anti-Schizosaccharomyces pombe (strain 972/24843)(Fission yeast) aps2 Polyclonal Antibody

Sign In for Pricing
View Details
amaR OnePCR HiFi, 20 uL for each total RXN volume
SM215-0010 10 Reactions (100 µL)

amaR OnePCR HiFi, 20 uL for each total RXN volume

Sign In for Pricing
View Details