Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-3473g miRNA Agomir/Antagomir

MicroRNA: mmu-miR-3473g Accession Number: MIMAT0031427 Mature Sequence: CAAAAGUGAGGCUGGGGAGA mmu-miR-3473g are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-3473g in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-3473g miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

M/M054/DE330/RFL-390X590-1 AC Signs
303316 Pack of 1 Pictogram(s)

M/M054/DE330/RFL-390X590-1 AC Signs

Sign In for Pricing
View Details
CD8A (Cytotoxic-&Suppressor T-Cell Marker) (rC8/468), CF594 conjugate, 0.1mg/mL
BNC941867-100 1x 100 µL

CD8A (Cytotoxic-&Suppressor T-Cell Marker) (rC8/468), CF594 conjugate, 0.1mg/mL

Sign In for Pricing
View Details
Zhx3 (NM_177263) Mouse Tagged ORF Clone
MR211285 10 µg

Zhx3 (NM_177263) Mouse Tagged ORF Clone

Sign In for Pricing
View Details
OR6Q1 CRISPR/Cas9 KO Plasmid (h)
sc-415084 20 µg

OR6Q1 CRISPR/Cas9 KO Plasmid (h)

Sign In for Pricing
View Details
Anti Human Frataxin Mab Rat
272480 100 µg

Anti Human Frataxin Mab Rat

Sign In for Pricing
View Details
Pth Antibody
orb825247 2 mg

Pth Antibody

Sign In for Pricing
View Details