Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-8119 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-8119 Accession Number: MIMAT0031425 Mature Sequence: GAGGAGAGGGAGCUAGGGUC mmu-miR-8119 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-8119 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-8119 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

CD86 Protein Vector (Human) (pPB-C-His)
PV008581 500 ng

CD86 Protein Vector (Human) (pPB-C-His)

Sign In for Pricing
View Details
Olfr1107 3'UTR GFP Stable Cell Line
TU164632 1.0 mL

Olfr1107 3'UTR GFP Stable Cell Line

Sign In for Pricing
View Details
PRAME (Preferentially Expressed Antigen of Melanoma, Melanoma Antigen Preferentially Expressed in Tumors, MAPE, CT130, OPA Interacting Protein 4, OPA-interacting Protein 4, Opa-interacting Protein OIP4, OIP4) (MaxLight 650)
131739-ML650 100 µL

PRAME (Preferentially Expressed Antigen of Melanoma, Melanoma Antigen Preferentially Expressed in Tumors, MAPE, CT130, OPA Interacting Protein 4, OPA-interacting Protein 4, Opa-interacting Protein OIP4, OIP4) (MaxLight 650)

Sign In for Pricing
View Details
Recombinant Human C-C motif chemokine 3-like 1 Protein, Untagged, E.coli-20ug
QP10225-ec-20ug 20ug

Recombinant Human C-C motif chemokine 3-like 1 Protein, Untagged, E.coli-20ug

Sign In for Pricing
View Details
Lentiviral mouse 6430548M08Rik shRNA (UAS) - Lentiviral mouse 6430548M08Rik shRNA (UAS, iRFP) (100)
GTR15158667 1 Vial

Lentiviral mouse 6430548M08Rik shRNA (UAS) - Lentiviral mouse 6430548M08Rik shRNA (UAS, iRFP) (100)

Sign In for Pricing
View Details
BMP-2, 283-396aa, Human, E.coli
E53A01349 50 µg

BMP-2, 283-396aa, Human, E.coli

Sign In for Pricing
View Details