Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-let-7f-2-3p miRNA Agomir/Antagomir

MicroRNA: mmu-let-7f-2-3p Accession Number: MIMAT0017017 Mature Sequence: CUAUACAGUCUACUGUCUUUC mmu-let-7f-2-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-let-7f-2-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-let-7f-2-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rabbit Anti-Human SLC35A2 pAb
PA15534-01 50 μL

Rabbit Anti-Human SLC35A2 pAb

Sign In for Pricing
View Details
Rabbit Anti-Human SLC35A2 pAb
PA15534-02 100 μL

Rabbit Anti-Human SLC35A2 pAb

Sign In for Pricing
View Details
CTDSPL (CTD Small Phosphatase-like Protein, CTDSP-like, Carboxy-terminal Domain RNA Polymerase II Polypeptide A Small Phosphatase 3, NIF-like Protein, Nuclear LIM Interactor-interacting Factor 1, NLI-interacting Factor 1, Protein YA22, hYA22, RBSP3, Small C-terminal Domain Phosphatase 3, SCP3, Small CTD Phosphatase 3, C3orf8, NIF1, NIFL, SCP3, YA22) discontinued
151376 100 µg

CTDSPL (CTD Small Phosphatase-like Protein, CTDSP-like, Carboxy-terminal Domain RNA Polymerase II Polypeptide A Small Phosphatase 3, NIF-like Protein, Nuclear LIM Interactor-interacting Factor 1, NLI-interacting Factor 1, Protein YA22, hYA22, RBSP3, Small C-terminal Domain Phosphatase 3, SCP3, Small CTD Phosphatase 3, C3orf8, NIF1, NIFL, SCP3, YA22) discontinued

Sign In for Pricing
View Details
Zfp526 AAV Vector (Mouse) (CMV)
51014104 1 µg

Zfp526 AAV Vector (Mouse) (CMV)

Sign In for Pricing
View Details
EIF2C1, NT (Protein Argonaute-1, Argonaute1, hAgo1, Eukaryotic Translation Initiation Factor 2C 1, eIF-2C 1, eIF2C 1, Putative RNA-binding Protein Q99, AGO1)
E2237-25C 200 µL

EIF2C1, NT (Protein Argonaute-1, Argonaute1, hAgo1, Eukaryotic Translation Initiation Factor 2C 1, eIF-2C 1, eIF2C 1, Putative RNA-binding Protein Q99, AGO1)

Sign In for Pricing
View Details
Rabbit Polyclonal VARS Antibody [Alexa Fluor 647]
NBP3-05970AF647 0.1 mL

Rabbit Polyclonal VARS Antibody [Alexa Fluor 647]

Sign In for Pricing
View Details