Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-let-7f-5p miRNA Agomir/Antagomir

MicroRNA: mmu-let-7f-5p Accession Number: MIMAT0000525 Mature Sequence: UGAGGUAGUAGAUUGUAUAGUU mmu-let-7f-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-let-7f-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-let-7f-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

C130026I21Rik (BC007193) Mouse Tagged ORF Clone Lentiviral Particle
MR206232L4V 200 µL

C130026I21Rik (BC007193) Mouse Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
Olr1460 AAV siRNA Pooled Vector
33958166 1.0 µg

Olr1460 AAV siRNA Pooled Vector

Sign In for Pricing
View Details
EMD Knockout NCI-H1975 Polyclonal Cells
ARG17178 1 Million

EMD Knockout NCI-H1975 Polyclonal Cells

Sign In for Pricing
View Details
LRFN2, CT (LRFN2, KIAA1246, SALM1, Leucine-rich repeat and fibronectin type-III domain-containing protein 2, Synaptic adhesion-like molecule 1) (Azide free) (HRP) discontinued
037927-HRP 200 µL

LRFN2, CT (LRFN2, KIAA1246, SALM1, Leucine-rich repeat and fibronectin type-III domain-containing protein 2, Synaptic adhesion-like molecule 1) (Azide free) (HRP) discontinued

Sign In for Pricing
View Details
Human recombinant IL-18BP (Interleukin-18-binding protein) protein, AF
PROTO95998-4-100ug 100 µg

Human recombinant IL-18BP (Interleukin-18-binding protein) protein, AF

Sign In for Pricing
View Details
Human GLRX shRNA Plasmid
abx951829-01 150 µg

Human GLRX shRNA Plasmid

Sign In for Pricing
View Details