Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-8116 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-8116 Accession Number: MIMAT0031422 Mature Sequence: AAGGAUCCGGGGCUAGUUGGC mmu-miR-8116 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-8116 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-8116 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

HDAC4 Human Knockdown Lysate
LY300197 100 µg

HDAC4 Human Knockdown Lysate

Sign In for Pricing
View Details
FES (NM_001143785) Human Over-expression Lysate
LC428346 20 µg

FES (NM_001143785) Human Over-expression Lysate

Sign In for Pricing
View Details
Integrin β3 (Ab-785) Antibody
8B7119-AAT 50 µg

Integrin β3 (Ab-785) Antibody

Sign In for Pricing
View Details
Chicken IgM (mu chain) Secondary Antibody
TA397596 1 mg

Chicken IgM (mu chain) Secondary Antibody

Sign In for Pricing
View Details
Bmp2 Mouse Gene Knockout Kit (CRISPR)
KN502194 1 Kit

Bmp2 Mouse Gene Knockout Kit (CRISPR)

Sign In for Pricing
View Details
ABCA7 Human Gene Knockout Kit (CRISPR)
KN416823 1 Kit

ABCA7 Human Gene Knockout Kit (CRISPR)

Sign In for Pricing
View Details