Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-6237 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6237 Accession Number: MIMAT0024858 Mature Sequence: UUAAGGAUUGGGUCUUGGAAUUC mmu-miR-6237 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-6237 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-6237 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Porcine X Box Binding Protein 1 ELISA kit
GTR10438388 96 Well

Porcine X Box Binding Protein 1 ELISA kit

Sign In for Pricing
View Details
PLA2G4E (Cytosolic Phospholipase A2 epsilon, cPLA2-epsilon, Phospholipase A2 group IVE, PLA2G4E) (AP)
MBS6458186-01 0.1 mL

PLA2G4E (Cytosolic Phospholipase A2 epsilon, cPLA2-epsilon, Phospholipase A2 group IVE, PLA2G4E) (AP)

Sign In for Pricing
View Details
PLA2G4E (Cytosolic Phospholipase A2 epsilon, cPLA2-epsilon, Phospholipase A2 group IVE, PLA2G4E) (AP)
MBS6458186-02 5x 0.1 mL

PLA2G4E (Cytosolic Phospholipase A2 epsilon, cPLA2-epsilon, Phospholipase A2 group IVE, PLA2G4E) (AP)

Sign In for Pricing
View Details
Zfp187 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
50868114 3x 1.0 µg

Zfp187 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

Sign In for Pricing
View Details
Rat Adenylate Cyclase Activating Polypeptide 1 Pituitary ADCYAP1 ELISA Kit
BG-RAT10063 1 Each

Rat Adenylate Cyclase Activating Polypeptide 1 Pituitary ADCYAP1 ELISA Kit

Sign In for Pricing
View Details
Laminin β-1 (LT3) Alexa Fluor® 488
sc-33709 AF488 200 µg/mL

Laminin β-1 (LT3) Alexa Fluor® 488

Sign In for Pricing
View Details