Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-8114 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-8114 Accession Number: MIMAT0031420 Mature Sequence: UCACCCAUCUCCUCUCCGCCU mmu-miR-8114 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-8114 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-8114 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

CBR1 Antibody
R34191-100UG 100 µg

CBR1 Antibody

Sign In for Pricing
View Details
JAKMIP2 Polyclonal Antibody
E914387 100 µL

JAKMIP2 Polyclonal Antibody

Sign In for Pricing
View Details
FKBP2 (N-term) Rabbit Polyclonal Antibody
E10G30400 100 µL

FKBP2 (N-term) Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
ZDHHC2 (NM_016353) Human Over-expression Lysate
LH10048V 100 µg

ZDHHC2 (NM_016353) Human Over-expression Lysate

Sign In for Pricing
View Details
Anti-ADAM20
orb1133697 100 µL

Anti-ADAM20

Sign In for Pricing
View Details
SSTr4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
45557061 1.0 µg DNA

SSTr4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

Sign In for Pricing
View Details