Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-8113 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-8113 Accession Number: MIMAT0031419 Mature Sequence: CAGGAGAGUCAGGGGCAAGUAG mmu-miR-8113 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-8113 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-8113 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

NOS3 (Nitric Oxide Synthase, Endothelial, Constitutive NOS, cNOS, EC-NOS, Endothelial NOS, eNOS, NOS Type III, NOSIII) (MaxLight 750) discontinued
130475-ML750 100 µL

NOS3 (Nitric Oxide Synthase, Endothelial, Constitutive NOS, cNOS, EC-NOS, Endothelial NOS, eNOS, NOS Type III, NOSIII) (MaxLight 750) discontinued

Sign In for Pricing
View Details
Rabbit anti-Arabidopsis thaliana (Mouse-ear cress) SCPL28 Polyclonal Antibody
MBS9005863 Inquire

Rabbit anti-Arabidopsis thaliana (Mouse-ear cress) SCPL28 Polyclonal Antibody

Sign In for Pricing
View Details
SH3D20, ID (ARHGAP27, CAMGAP1, SH3D20, Rho GTPase-activating protein 27, CIN85-associated multi-domain-containing Rho GTPase-activating protein 1, Rho-type GTPase-activating protein 27, SH3 domain-containing protein 20) (Biotin) discontinued
041692-Biotin 200 µL

SH3D20, ID (ARHGAP27, CAMGAP1, SH3D20, Rho GTPase-activating protein 27, CIN85-associated multi-domain-containing Rho GTPase-activating protein 1, Rho-type GTPase-activating protein 27, SH3 domain-containing protein 20) (Biotin) discontinued

Sign In for Pricing
View Details
5-HETE (5-Hydroxyeicosatetraenoic Acid) ELISA Kit
ELK8155-01 48 Tests

5-HETE (5-Hydroxyeicosatetraenoic Acid) ELISA Kit

Sign In for Pricing
View Details
5-HETE (5-Hydroxyeicosatetraenoic Acid) ELISA Kit
ELK8155-02 96 Tests

5-HETE (5-Hydroxyeicosatetraenoic Acid) ELISA Kit

Sign In for Pricing
View Details
5-HETE (5-Hydroxyeicosatetraenoic Acid) ELISA Kit
ELK8155-03 5x 96 Tests

5-HETE (5-Hydroxyeicosatetraenoic Acid) ELISA Kit

Sign In for Pricing
View Details