Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-3082-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-3082-5p Accession Number: MIMAT0014872 Mature Sequence: GACAGAGUGUGUGUGUCUGUGU mmu-miR-3082-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-3082-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-3082-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

RXRG Protein Vector (Rat) (pPM-C-HA)
42916026 500 ng

RXRG Protein Vector (Rat) (pPM-C-HA)

Sign In for Pricing
View Details
IRE1 Polyclonal Antibody, Cy5 Conjugated
bs-8680R-Cy5-01 20 µL

IRE1 Polyclonal Antibody, Cy5 Conjugated

Sign In for Pricing
View Details
IRE1 Polyclonal Antibody, Cy5 Conjugated
bs-8680R-Cy5-02 100 µL

IRE1 Polyclonal Antibody, Cy5 Conjugated

Sign In for Pricing
View Details
Rabbit anti-Pseudomonas aeruginosa (strain 15692/DSM 22644/CIP 104116/JCM 14847/LMG 12228/1C/PRS 101/PAO1) MNTH1 Polyclonal Antibody
MBS9012206 Inquire

Rabbit anti-Pseudomonas aeruginosa (strain 15692/DSM 22644/CIP 104116/JCM 14847/LMG 12228/1C/PRS 101/PAO1) MNTH1 Polyclonal Antibody

Sign In for Pricing
View Details
Rabbit Monoclonal ALCAM/CD166 Antibody (2599C) [DyLight 650]
FAB6563W 0.1 mL

Rabbit Monoclonal ALCAM/CD166 Antibody (2599C) [DyLight 650]

Sign In for Pricing
View Details
MGMT (O-6-Methylguanine DNA Methyltransferase, 6-O-Methylguanine DNA Methyltransferase, Methylated DNA Protein Cysteine Methyltransferase, Methylguanine DNA Methyltransferase, O-6-Methylguanine DNA Alkyltransferase) (MaxLight 550) discontinued
129659-ML550 100 µL

MGMT (O-6-Methylguanine DNA Methyltransferase, 6-O-Methylguanine DNA Methyltransferase, Methylated DNA Protein Cysteine Methyltransferase, Methylguanine DNA Methyltransferase, O-6-Methylguanine DNA Alkyltransferase) (MaxLight 550) discontinued

Sign In for Pricing
View Details