Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-8111 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-8111 Accession Number: MIMAT0031417 Mature Sequence: ACCGGGCAUGGUAGUGUACAC mmu-miR-8111 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-8111 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-8111 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Human Olig1 2 3 MAb (Clone 257224)
MAB2230 100 µg

Human Olig1 2 3 MAb (Clone 257224)

Sign In for Pricing
View Details
Rabbit Anti-Nur77, Alexa Fluor 647 conjugated antibody
SL22601R-AF647-01 Inquire

Rabbit Anti-Nur77, Alexa Fluor 647 conjugated antibody

Sign In for Pricing
View Details
Rabbit Anti-Nur77, Alexa Fluor 647 conjugated antibody
SL22601R-AF647-02 100 µL

Rabbit Anti-Nur77, Alexa Fluor 647 conjugated antibody

Sign In for Pricing
View Details
Lentiviral human JSRP1 sgRNA gene knockout kit - Lentiviral human JSRP1 sgRNA gene knockout kit (100)
GTR15388366 1 Vial

Lentiviral human JSRP1 sgRNA gene knockout kit - Lentiviral human JSRP1 sgRNA gene knockout kit (100)

Sign In for Pricing
View Details
Alimemazine hemitartrate 25mg
A17754-25 25 mg

Alimemazine hemitartrate 25mg

Sign In for Pricing
View Details
Lentiviral human OR2S2 sgRNA gene knockout kit - Lentiviral human OR2S2 sgRNA gene knockout kit (100)
GTR15379630 1 Vial

Lentiviral human OR2S2 sgRNA gene knockout kit - Lentiviral human OR2S2 sgRNA gene knockout kit (100)

Sign In for Pricing
View Details