Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-1972 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-1972 Accession Number: MIMAT0009447 Mature Sequence: UCAGGCCAGGCACAGUGGCUCA hsa-miR-1972 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-1972 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-1972 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

FRA11E 3'UTR GFP Stable Cell Line
TU058231 1.0 mL

FRA11E 3'UTR GFP Stable Cell Line

Sign In for Pricing
View Details
KIAA1409 CRISPR Knock Out 293T Cell Line (Human)
60872141 1x 10^6 Cells / 1.0 mL

KIAA1409 CRISPR Knock Out 293T Cell Line (Human)

Sign In for Pricing
View Details
Cdh19 (NM_001009448) Rat Untagged Clone
RN207942 10 µg

Cdh19 (NM_001009448) Rat Untagged Clone

Sign In for Pricing
View Details
Anti-SARS-CoV-2 Spike Protein (Trimer) Human IgA ELISA Kit
AK474108 96 Tests

Anti-SARS-CoV-2 Spike Protein (Trimer) Human IgA ELISA Kit

Sign In for Pricing
View Details
FYCO1 (NM_024513) Human Tagged Lenti ORF Clone
RC215323L4 10 µg

FYCO1 (NM_024513) Human Tagged Lenti ORF Clone

Sign In for Pricing
View Details
Canine Neuregulin-1 HEK293 Overexpression Lysate
MBS8117278-01 0.3 mg

Canine Neuregulin-1 HEK293 Overexpression Lysate

Sign In for Pricing
View Details