Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-1972 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-1972 Accession Number: MIMAT0009447 Mature Sequence: UCAGGCCAGGCACAGUGGCUCA hsa-miR-1972 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-1972 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-1972 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

NIPAL4 CytoSection
TS414908P5 25 Slides

NIPAL4 CytoSection

Sign In for Pricing
View Details
Α-enolase (ENO1) Antibody (IgA) Mouse ELISA Kit
B4119 96 Tests

Α-enolase (ENO1) Antibody (IgA) Mouse ELISA Kit

Sign In for Pricing
View Details
BRD2 Protein Vector (Mouse) (pPM-C-HA)
PV159824 500 ng

BRD2 Protein Vector (Mouse) (pPM-C-HA)

Sign In for Pricing
View Details
IgG, Rabbit Isotype Control (PE)
I1904-30G 100 Tests

IgG, Rabbit Isotype Control (PE)

Sign In for Pricing
View Details
Rabbit Polyclonal ADP-Sugar Pyrophosphatase/NUDT5 Antibody [DyLight 405]
NBP2-99496V 0.1 mL

Rabbit Polyclonal ADP-Sugar Pyrophosphatase/NUDT5 Antibody [DyLight 405]

Sign In for Pricing
View Details
Recombinant Xeroderma Pigmentosum, Complementation Group D (XPD)
SIPC008Hu01-01 10 µg

Recombinant Xeroderma Pigmentosum, Complementation Group D (XPD)

Sign In for Pricing
View Details