Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-6860 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-6860 Accession Number: MIMAT0027622 Mature Sequence: ACUGGGCAGGGCUGUGGUGAGU hsa-miR-6860 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-6860 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-6860 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

GENLISA™ Monkey Transthyretin (TTR) ELISA
KLW0262 1x 96 Well

GENLISA™ Monkey Transthyretin (TTR) ELISA

Sign In for Pricing
View Details
CD20/MS4A1 Rabbit Polyclonal Antibody (Carrier-free)
orb3079045 100 µg

CD20/MS4A1 Rabbit Polyclonal Antibody (Carrier-free)

Sign In for Pricing
View Details
PRAC (Small Nuclear Protein PRAC, Prostate, Rectum and Colon Expressed Gene pro, C17orf92, MGC32520) (MaxLight 750) discontinued
138238-ML750 100 µL

PRAC (Small Nuclear Protein PRAC, Prostate, Rectum and Colon Expressed Gene pro, C17orf92, MGC32520) (MaxLight 750) discontinued

Sign In for Pricing
View Details
Human Tissue factor ELISA Kit
EK1868 Inquire

Human Tissue factor ELISA Kit

Sign In for Pricing
View Details
SLC38A3 3'UTR Luciferase Stable Cell Line
TU023603 1.0 mL

SLC38A3 3'UTR Luciferase Stable Cell Line

Sign In for Pricing
View Details
OXSR1 (Oxidative-Stress Responsive 1, KIAA1101, OSR1) (Biotin)
249680-Biotin 100 µL

OXSR1 (Oxidative-Stress Responsive 1, KIAA1101, OSR1) (Biotin)

Sign In for Pricing
View Details