Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-586 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-586 Accession Number: MIMAT0003252 Mature Sequence: UAUGCAUUGUAUUUUUAGGUCC hsa-miR-586 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-586 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-586 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Sheep Ovary Granulosa Cells
RPC-1132 5x 10^5

Sheep Ovary Granulosa Cells

Sign In for Pricing
View Details
Plxna4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4279603 1.0 µg DNA

Plxna4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

Sign In for Pricing
View Details
Beta-actin discontinued
533591-01 30ul

Beta-actin discontinued

Sign In for Pricing
View Details
Beta-actin discontinued
533591-02 100 µL

Beta-actin discontinued

Sign In for Pricing
View Details
PDCD2 (Programmed Cell Death Protein 2, Zinc Finger MYND Domain-containing Protein 7, Zinc Finger Protein Rp-8, RP8, ZMYND7, MGC12347) (AP) discontinued
131032-AP 100 µL

PDCD2 (Programmed Cell Death Protein 2, Zinc Finger MYND Domain-containing Protein 7, Zinc Finger Protein Rp-8, RP8, ZMYND7, MGC12347) (AP) discontinued

Sign In for Pricing
View Details
DC Current Meter MR-100
1091500/16A 1 Each

DC Current Meter MR-100

Sign In for Pricing
View Details