Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-3655 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-3655 Accession Number: MIMAT0018075 Mature Sequence: GCUUGUCGCUGCGGUGUUGCU hsa-miR-3655 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-3655 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-3655 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Chicken GSKIP / GSK3-beta interaction protein Recombinant Protein
R15172c 1 Each

Chicken GSKIP / GSK3-beta interaction protein Recombinant Protein

Sign In for Pricing
View Details
Lentiviral mouse Prdm15 shRNA (UAS) - Lentiviral mouse Prdm15 shRNA (UAS, GFP) plasmid
GTR15305557 1 Vial

Lentiviral mouse Prdm15 shRNA (UAS) - Lentiviral mouse Prdm15 shRNA (UAS, GFP) plasmid

Sign In for Pricing
View Details
CNOT7 Protein Vector (Human) (pPM-C-HA)
16495021 500 ng

CNOT7 Protein Vector (Human) (pPM-C-HA)

Sign In for Pricing
View Details
Polyclonal Antibody to Hydroxyacyl Coenzyme A Dehydrogenase Beta (HADHb)
TRV-0058568-01 20 µL

Polyclonal Antibody to Hydroxyacyl Coenzyme A Dehydrogenase Beta (HADHb)

Sign In for Pricing
View Details
Polyclonal Antibody to Hydroxyacyl Coenzyme A Dehydrogenase Beta (HADHb)
TRV-0058568-02 100 µL

Polyclonal Antibody to Hydroxyacyl Coenzyme A Dehydrogenase Beta (HADHb)

Sign In for Pricing
View Details
Polyclonal Antibody to Hydroxyacyl Coenzyme A Dehydrogenase Beta (HADHb)
TRV-0058568-03 200 µL

Polyclonal Antibody to Hydroxyacyl Coenzyme A Dehydrogenase Beta (HADHb)

Sign In for Pricing
View Details