Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4698 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4698 Accession Number: MIMAT0019793 Mature Sequence: UCAAAAUGUAGAGGAAGACCCCA hsa-miR-4698 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4698 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4698 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

ITGB2 (ITGB2, CD18, MFI7, Integrin beta-2, Cell surface adhesion glycoproteins LFA-1/CR3/p150,95 subunit beta, Complement receptor C3 subunit beta, CD18) (MaxLight 650) discontinued
037147-ML650 100 µL

ITGB2 (ITGB2, CD18, MFI7, Integrin beta-2, Cell surface adhesion glycoproteins LFA-1/CR3/p150,95 subunit beta, Complement receptor C3 subunit beta, CD18) (MaxLight 650) discontinued

Sign In for Pricing
View Details
UNC13D Antibody
A58971-50UG 50 µg

UNC13D Antibody

Sign In for Pricing
View Details
IL-32α Protein (N-Trx, Human)
P516222 100 µg

IL-32α Protein (N-Trx, Human)

Sign In for Pricing
View Details
Recombinant Human ERBB4/Her4 Protein, C-His
EHH06102 100 μg

Recombinant Human ERBB4/Her4 Protein, C-His

Sign In for Pricing
View Details
Clematomandshurica saponin C
HY-N4229-01 10 mg

Clematomandshurica saponin C

Sign In for Pricing
View Details
Clematomandshurica saponin C
HY-N4229-02 25 mg

Clematomandshurica saponin C

Sign In for Pricing
View Details