Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-548l miRNA Agomir/Antagomir

MicroRNA: hsa-miR-548l Accession Number: MIMAT0005889 Mature Sequence: AAAAGUAUUUGCGGGUUUUGUC hsa-miR-548l are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-548l in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-548l miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

TMEM1 (Trafficking Protein Particle Complex 10, EHOC-1, EHOC1, GT334, TMEM1, TRS130, TRS30) (MaxLight 750) discontinued
252790-ML750 100 µL

TMEM1 (Trafficking Protein Particle Complex 10, EHOC-1, EHOC1, GT334, TMEM1, TRS130, TRS30) (MaxLight 750) discontinued

Sign In for Pricing
View Details
RAT ANTI MOUSE CD206:Biotin
MBS215660-01 0.1 mg

RAT ANTI MOUSE CD206:Biotin

Sign In for Pricing
View Details
RAT ANTI MOUSE CD206:Biotin
MBS215660-02 5x 0.1 mg

RAT ANTI MOUSE CD206:Biotin

Sign In for Pricing
View Details
RPA32 (Replication Protein A 32kD Subunit, Replication Factor A Protein 2, Replication Protein A2 (32kD), Replication Protein A2 32kDa, REPA2, RPA2, HSSB, p32, p34, RF-A Protein 2, RPA p32, RP-A p34, RPA34) (MaxLight 750) discontinued
R3400-02M-ML750 100 µL

RPA32 (Replication Protein A 32kD Subunit, Replication Factor A Protein 2, Replication Protein A2 (32kD), Replication Protein A2 32kDa, REPA2, RPA2, HSSB, p32, p34, RF-A Protein 2, RPA p32, RP-A p34, RPA34) (MaxLight 750) discontinued

Sign In for Pricing
View Details
Rabbit Polyclonal WBP11 Antibody [DyLight 405]
NBP2-97493V 0.1 mL

Rabbit Polyclonal WBP11 Antibody [DyLight 405]

Sign In for Pricing
View Details
Bovine Glypican 4 GPC4 ELISA Kit
BG-BVN11124 1 Each

Bovine Glypican 4 GPC4 ELISA Kit

Sign In for Pricing
View Details