Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-6506-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-6506-3p Accession Number: MIMAT0025469 Mature Sequence: UCGUAUCAGAGAUUCCAGACAC hsa-miR-6506-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-6506-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-6506-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rabbit anti-Saccharomyces cerevisiae (strain 204508/S288c)(Baker's yeast) MVD1 Polyclonal Antibody
MBS7140589 Inquire

Rabbit anti-Saccharomyces cerevisiae (strain 204508/S288c)(Baker's yeast) MVD1 Polyclonal Antibody

Sign In for Pricing
View Details
Human PLSCR3 Recombinant Protein
PROTQ9NRY6-20ug 20 µg

Human PLSCR3 Recombinant Protein

Sign In for Pricing
View Details
Coronavirus (SARS-CoV Envelope) antigen (aa 1-76), (recombinant)
ENZ-PRT285-0100 100 µg

Coronavirus (SARS-CoV Envelope) antigen (aa 1-76), (recombinant)

Sign In for Pricing
View Details
MMP13 Protein Vector (Human) (pPM-C-His)
PV026160 500 ng

MMP13 Protein Vector (Human) (pPM-C-His)

Sign In for Pricing
View Details
Human OTUD4 (OTU domain-containing protein 4) ELISA
EH10806 96 Tests

Human OTUD4 (OTU domain-containing protein 4) ELISA

Sign In for Pricing
View Details
Rabbit Polyclonal AHI1 Antibody [Alexa Fluor 350]
NBP1-78206AF350 0.1 mL

Rabbit Polyclonal AHI1 Antibody [Alexa Fluor 350]

Sign In for Pricing
View Details