Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4313 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4313 Accession Number: MIMAT0016865 Mature Sequence: AGCCCCCUGGCCCCAAACCC hsa-miR-4313 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4313 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4313 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Cth Mouse Pre-designed siRNA Set A
HY-RS17261 1 Set

Cth Mouse Pre-designed siRNA Set A

Sign In for Pricing
View Details
15-deoxy-Δ12,14-Prostaglandin A2
sc-223167A 1 mg

15-deoxy-Δ12,14-Prostaglandin A2

Sign In for Pricing
View Details
N-Boc-PEG5-bromide
T16218 100 mg

N-Boc-PEG5-bromide

Sign In for Pricing
View Details
CPXM Rabbit Polyclonal Antibody (PE-Cy7)
orb881397 100 µL

CPXM Rabbit Polyclonal Antibody (PE-Cy7)

Sign In for Pricing
View Details
Bovine KAF/AR ELISA Kit
EBK0069 96 Tests

Bovine KAF/AR ELISA Kit

Sign In for Pricing
View Details
Phenylalanine (OVA - Conjugated)
OOCD00393-10UG 10 µg

Phenylalanine (OVA - Conjugated)

Sign In for Pricing
View Details