Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-6807-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-6807-5p Accession Number: MIMAT0027514 Mature Sequence: GUGAGCCAGUGGAAUGGAGAGG hsa-miR-6807-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-6807-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-6807-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rabbit Polyclonal Dysbindin Antibody
NBP3-30425 100 µg

Rabbit Polyclonal Dysbindin Antibody

Sign In for Pricing
View Details
Frozen Tissue Blocks, Lung: right upper lobe
CB520483 1 Block

Frozen Tissue Blocks, Lung: right upper lobe

Sign In for Pricing
View Details
Zfp598 (NM_001105770) Rat Untagged Clone
RN214917 10 µg

Zfp598 (NM_001105770) Rat Untagged Clone

Sign In for Pricing
View Details
Mouse Akr1c21 qPCR Primer Pair
QM45558S 200 Tests

Mouse Akr1c21 qPCR Primer Pair

Sign In for Pricing
View Details
Anti-CCK antibody
STJ92071 200 µl

Anti-CCK antibody

Sign In for Pricing
View Details
Human Mitotic Checkpoint Serine/threonine-Protein Kinase BUB1 (BUB1) ELISA Kit
JL52779-01 48 Tests

Human Mitotic Checkpoint Serine/threonine-Protein Kinase BUB1 (BUB1) ELISA Kit

Sign In for Pricing
View Details