Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-5589-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-5589-3p Accession Number: MIMAT0022298 Mature Sequence: UGCACAUGGCAACCUAGCUCCCA hsa-miR-5589-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-5589-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-5589-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Recombinant Human Hemoglobin subunit zeta Protein, GST, E.coli-1mg
QP6148-ec-1mg 1mg

Recombinant Human Hemoglobin subunit zeta Protein, GST, E.coli-1mg

Sign In for Pricing
View Details
MIB1 Antibody
A49707-50UG 50 µg

MIB1 Antibody

Sign In for Pricing
View Details
Elk3 sgRNA CRISPR Lentivector set (Mouse)
K4845801 3x 1.0 µg

Elk3 sgRNA CRISPR Lentivector set (Mouse)

Sign In for Pricing
View Details
Ki-67 (Proliferating Cell Marker) Recombinant Rabbit Monoclonal Antibody [Clone MKI67/6517R]
MBS4382090-01 0.02 mg (With BSA & Azide at 0.2mg/mL)

Ki-67 (Proliferating Cell Marker) Recombinant Rabbit Monoclonal Antibody [Clone MKI67/6517R]

Sign In for Pricing
View Details
Ki-67 (Proliferating Cell Marker) Recombinant Rabbit Monoclonal Antibody [Clone MKI67/6517R]
MBS4382090-02 0.1 mg (With BSA & Azide at 0.2mg/mL)

Ki-67 (Proliferating Cell Marker) Recombinant Rabbit Monoclonal Antibody [Clone MKI67/6517R]

Sign In for Pricing
View Details
Ki-67 (Proliferating Cell Marker) Recombinant Rabbit Monoclonal Antibody [Clone MKI67/6517R]
MBS4382090-03 0.1 mg (Without BSA & Azide at 1mg/mL)

Ki-67 (Proliferating Cell Marker) Recombinant Rabbit Monoclonal Antibody [Clone MKI67/6517R]

Sign In for Pricing
View Details