Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-3939 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-3939 Accession Number: MIMAT0018355 Mature Sequence: UACGCGCAGACCACAGGAUGUC hsa-miR-3939 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-3939 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-3939 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

STAT1 Antibody
MBS7130794-01 0.1 mL

STAT1 Antibody

Ask
View Details
STAT1 Antibody
MBS7130794-02 5x 0.1 mL

STAT1 Antibody

Ask
View Details
CNO (Biogenesis of lysosome-Related organelles Complex 1 Subunit 4, BLOC-1 Subunit 4, Protein cappuccino Homolog, BLOC1S4, CNO) (MaxLight 405) discontinued
302361-ML405 100 µL

CNO (Biogenesis of lysosome-Related organelles Complex 1 Subunit 4, BLOC-1 Subunit 4, Protein cappuccino Homolog, BLOC1S4, CNO) (MaxLight 405) discontinued

Ask
View Details
Recombinant Zea mays Zein-alpha PZ22.1/22A1
MBS1250283-01 0.02 mg (E-Coli)

Recombinant Zea mays Zein-alpha PZ22.1/22A1

Ask
View Details
Recombinant Zea mays Zein-alpha PZ22.1/22A1
MBS1250283-02 0.1 mg (E-Coli)

Recombinant Zea mays Zein-alpha PZ22.1/22A1

Ask
View Details
Recombinant Zea mays Zein-alpha PZ22.1/22A1
MBS1250283-03 0.02 mg (Yeast)

Recombinant Zea mays Zein-alpha PZ22.1/22A1

Ask
View Details