Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-130a-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-130a-3p Accession Number: MIMAT0000425 Mature Sequence: CAGUGCAAUGUUAAAAGGGCAU hsa-miR-130a-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-130a-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-130a-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Tris (trimethylsilyl) silane)
166993 1 g

Tris (trimethylsilyl) silane)

Sign In for Pricing
View Details
Kat7 Protein Vector (Human) (pPB-N-His)
PV088367 500 ng

Kat7 Protein Vector (Human) (pPB-N-His)

Sign In for Pricing
View Details
Asialoglycoprotein Receptor 1/HL-1 Recombinant Rabbit mAb
BS49131-01 50 µL

Asialoglycoprotein Receptor 1/HL-1 Recombinant Rabbit mAb

Sign In for Pricing
View Details
Asialoglycoprotein Receptor 1/HL-1 Recombinant Rabbit mAb
BS49131-02 100 µL

Asialoglycoprotein Receptor 1/HL-1 Recombinant Rabbit mAb

Sign In for Pricing
View Details
SLC9A3P3 CRISPR Knock Out 293T Cell Line (Human)
44298141 1x 10^6 Cells / 1.0 mL

SLC9A3P3 CRISPR Knock Out 293T Cell Line (Human)

Sign In for Pricing
View Details
Kir3.1, CT (GIRK1, KCNJ3, G-Protein Activated Inwardly Rectifying Potassium Channel) (PE) discontinued
031069-PE 100 µL

Kir3.1, CT (GIRK1, KCNJ3, G-Protein Activated Inwardly Rectifying Potassium Channel) (PE) discontinued

Sign In for Pricing
View Details