Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-3937 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-3937 Accession Number: MIMAT0018352 Mature Sequence: ACAGGCGGCUGUAGCAAUGGGGG hsa-miR-3937 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-3937 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-3937 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

ZNF236 Rabbit Polyclonal Antibody (Biotin)
orb2128252 100 µL

ZNF236 Rabbit Polyclonal Antibody (Biotin)

Sign In for Pricing
View Details
Tirap (NM_054096) Mouse Tagged ORF Clone Lentiviral Particle
MR225270L3V 200 µL

Tirap (NM_054096) Mouse Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
Porcine Leukocyte elastase inhibitor,SERPINB1 ELISA KIT
ELI-42000p 96 Tests

Porcine Leukocyte elastase inhibitor,SERPINB1 ELISA KIT

Sign In for Pricing
View Details
FNIP1 Antibody: Alkaline Phosphatase
MBS8000382-01 0.1 mg

FNIP1 Antibody: Alkaline Phosphatase

Sign In for Pricing
View Details
FNIP1 Antibody: Alkaline Phosphatase
MBS8000382-02 5x 0.1 mg

FNIP1 Antibody: Alkaline Phosphatase

Sign In for Pricing
View Details
Irf2bp1 Rat shRNA Plasmid (Locus ID 308404)
TR706039 1 Kit

Irf2bp1 Rat shRNA Plasmid (Locus ID 308404)

Sign In for Pricing
View Details