Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4803 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4803 Accession Number: MIMAT0019983 Mature Sequence: UAACAUAAUAGUGUGGAUUGA hsa-miR-4803 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4803 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4803 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Cystatin D (F-3) P
sc-398553 P 100 µg - 0.5 mL

Cystatin D (F-3) P

Sign In for Pricing
View Details
Lentiviral human ZNF135 shRNA (UAS) - Lentiviral human ZNF135 shRNA (UAS, GFP) (25)
GTR15344495 1 Vial

Lentiviral human ZNF135 shRNA (UAS) - Lentiviral human ZNF135 shRNA (UAS, GFP) (25)

Sign In for Pricing
View Details
Langya virus/LayV C Recombinant Protein
PPT-16150 100 µg

Langya virus/LayV C Recombinant Protein

Sign In for Pricing
View Details
Mouse DNA helicase INO80, Ino80 ELISA KIT
ELI-20450m 96 Tests

Mouse DNA helicase INO80, Ino80 ELISA KIT

Sign In for Pricing
View Details
Nkx6.2 Rabbit pAb
E47R19278 100 µL

Nkx6.2 Rabbit pAb

Sign In for Pricing
View Details
ALS2CR8, NT (ALS2CR8, CARF, Amyotrophic lateral sclerosis 2 chromosomal region candidate gene 8 protein, Calcium-response factor, Testis development protein NYD-SP24) (MaxLight 550) discontinued
031820-ML550 100 µL

ALS2CR8, NT (ALS2CR8, CARF, Amyotrophic lateral sclerosis 2 chromosomal region candidate gene 8 protein, Calcium-response factor, Testis development protein NYD-SP24) (MaxLight 550) discontinued

Sign In for Pricing
View Details