Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4802-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4802-3p Accession Number: MIMAT0019982 Mature Sequence: UACAUGGAUGGAAACCUUCAAGC hsa-miR-4802-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4802-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4802-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

TCLP Volatiles Spike
TCLP-VX 1 mL

TCLP Volatiles Spike

Sign In for Pricing
View Details
Anti-Amitryptiline [Clone AM10-106.9] - 100 μg
19201-100μg 100 µg

Anti-Amitryptiline [Clone AM10-106.9] - 100 μg

Sign In for Pricing
View Details
LARP4B Protein Vector (Human) (pPM-C-HA)
PV090468 500 ng

LARP4B Protein Vector (Human) (pPM-C-HA)

Sign In for Pricing
View Details
DPP4, ID (DPP4, ADCP2, CD26, Dipeptidyl peptidase 4, ADABP, Adenosine deaminase complexing protein 2, Dipeptidyl peptidase IV, T-cell activation antigen CD26, TP103, CD26, Dipeptidyl peptidase 4 membrane form, Dipeptidyl peptidase IV membrane form, Dipeptidyl peptidase 4 soluble form, Dipeptidyl peptidase IV soluble form) (MaxLight 550) discontinued
034782-ML550 100 µL

DPP4, ID (DPP4, ADCP2, CD26, Dipeptidyl peptidase 4, ADABP, Adenosine deaminase complexing protein 2, Dipeptidyl peptidase IV, T-cell activation antigen CD26, TP103, CD26, Dipeptidyl peptidase 4 membrane form, Dipeptidyl peptidase IV membrane form, Dipeptidyl peptidase 4 soluble form, Dipeptidyl peptidase IV soluble form) (MaxLight 550) discontinued

Sign In for Pricing
View Details
GPHN antibody
FNab03425 100 µg

GPHN antibody

Sign In for Pricing
View Details
PRICKLE1, CT (PRICKLE1, RILP, Prickle-like protein 1, REST/NRSF-interacting LIM domain protein 1) (MaxLight 550) discontinued
040430-ML550 100 µL

PRICKLE1, CT (PRICKLE1, RILP, Prickle-like protein 1, REST/NRSF-interacting LIM domain protein 1) (MaxLight 550) discontinued

Sign In for Pricing
View Details