Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4802-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4802-3p Accession Number: MIMAT0019982 Mature Sequence: UACAUGGAUGGAAACCUUCAAGC hsa-miR-4802-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4802-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4802-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

KCNQ2 (NM_172107) Human Over-expression Lysate
LY406840 100 µg

KCNQ2 (NM_172107) Human Over-expression Lysate

Sign In for Pricing
View Details
PHF3 Protein Vector (Rat) (pPB-N-His)
PV293783 500 ng

PHF3 Protein Vector (Rat) (pPB-N-His)

Sign In for Pricing
View Details
S35E2, NT (SLC35E2B, KIAA0447, Solute carrier family 35 member E2B) (Biotin)
MBS6344746-01 0.2 mL

S35E2, NT (SLC35E2B, KIAA0447, Solute carrier family 35 member E2B) (Biotin)

Sign In for Pricing
View Details
S35E2, NT (SLC35E2B, KIAA0447, Solute carrier family 35 member E2B) (Biotin)
MBS6344746-02 5x 0.2 mL

S35E2, NT (SLC35E2B, KIAA0447, Solute carrier family 35 member E2B) (Biotin)

Sign In for Pricing
View Details
Cortisol (Biotin)
C7904-02-Biotin 100 µL

Cortisol (Biotin)

Sign In for Pricing
View Details
Integrin, beta1 (CD29, Very Late Antigen, VLAb1, Platelet gplla, ITGB1, Fibrinogen Receptor beta Subunit, FNRB, Integrin VLA4 Subunit beta, MDF2, MSK12, Very Late Activation Protein beta Polypeptide, VLAB, VLAbeta) (Biotin) discontinued
I7661-38Q-Biotin 100 µL

Integrin, beta1 (CD29, Very Late Antigen, VLAb1, Platelet gplla, ITGB1, Fibrinogen Receptor beta Subunit, FNRB, Integrin VLA4 Subunit beta, MDF2, MSK12, Very Late Activation Protein beta Polypeptide, VLAB, VLAbeta) (Biotin) discontinued

Sign In for Pricing
View Details