Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-8089 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-8089 Accession Number: MIMAT0031016 Mature Sequence: CCUGGGGACAGGGGAUUGGGGCAG hsa-miR-8089 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-8089 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-8089 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

HS3ST3A1 ORF Vector (Human) (pORF)
ORF021165 1.0 µg DNA

HS3ST3A1 ORF Vector (Human) (pORF)

Sign In for Pricing
View Details
JMJD6 Recombinant Rabbit monoclonal Antibody
HA723703 100 µL

JMJD6 Recombinant Rabbit monoclonal Antibody

Sign In for Pricing
View Details
ZNF503 Protein Vector (Human) (pPM-C-HA)
51567022 500 ng

ZNF503 Protein Vector (Human) (pPM-C-HA)

Sign In for Pricing
View Details
Rabbit Polyclonal CTAGE1 Antibody [DyLight 550]
NBP2-99272R 0.1 mL

Rabbit Polyclonal CTAGE1 Antibody [DyLight 550]

Sign In for Pricing
View Details
Chorionic Gonadotropin, Human (hCG, Chorionic Gonadotropin alpha Polypeptide, Chorionic Gonadotrophin alpha Subunit, Choriogonadotropin alpha Chain, CG alpha, CG-alpha, CGA, CGA Protein, Chorionic Gonadotropin beta Chain, Chorionic Gonadotropin beta Polypeptide, Choriogonadotropin Subunit beta, Chorionic Gonadotropin beta Subunit, CG beta, CG-beta, CGB) discontinued
C5069-08S 1 mg

Chorionic Gonadotropin, Human (hCG, Chorionic Gonadotropin alpha Polypeptide, Chorionic Gonadotrophin alpha Subunit, Choriogonadotropin alpha Chain, CG alpha, CG-alpha, CGA, CGA Protein, Chorionic Gonadotropin beta Chain, Chorionic Gonadotropin beta Polypeptide, Choriogonadotropin Subunit beta, Chorionic Gonadotropin beta Subunit, CG beta, CG-beta, CGB) discontinued

Sign In for Pricing
View Details
Mouse Monoclonal Bax inhibitor 1 Antibody (20F430) [DyLight 350]
NBP2-24919UV 0.1 mL

Mouse Monoclonal Bax inhibitor 1 Antibody (20F430) [DyLight 350]

Sign In for Pricing
View Details