Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4469 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4469 Accession Number: MIMAT0018996 Mature Sequence: GCUCCCUCUAGGGUCGCUCGGA hsa-miR-4469 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4469 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4469 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

OR2P1P Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV737042 1.0 µg DNA

OR2P1P Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

Sign In for Pricing
View Details
Tgfbr3 3'UTR Luciferase Stable Cell Line
TU120417 1.0 mL

Tgfbr3 3'UTR Luciferase Stable Cell Line

Sign In for Pricing
View Details
ZXDC Protein Vector (Mouse) (pPM-C-HA)
PV251208 500 ng

ZXDC Protein Vector (Mouse) (pPM-C-HA)

Sign In for Pricing
View Details
ATRX Antibody
A39466-100UG 100 µg

ATRX Antibody

Sign In for Pricing
View Details
ZNF385B (NM_001113398) Human Tagged ORF Clone
RC225561 10 µg

ZNF385B (NM_001113398) Human Tagged ORF Clone

Sign In for Pricing
View Details
TMED8, ID (TMED8, FAM15B, Protein TMED8) (AP) discontinued
042929-AP 200 µL

TMED8, ID (TMED8, FAM15B, Protein TMED8) (AP) discontinued

Sign In for Pricing
View Details