Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-6501-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-6501-3p Accession Number: MIMAT0025459 Mature Sequence: CCAGAGCAGCCUGCGGUAACAGU hsa-miR-6501-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-6501-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-6501-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

ST3GAL6 (NM_006100) Human Over-expression Lysate
LC416864 20 µg

ST3GAL6 (NM_006100) Human Over-expression Lysate

Sign In for Pricing
View Details
RG9MTD2 (TRMT10A) (NM_001134665) Human Tagged ORF Clone Lentiviral Particle
RC225499L3V 200 µL

RG9MTD2 (TRMT10A) (NM_001134665) Human Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
TGF-b3 Polyclonal Antibody
5344-100 100 µg

TGF-b3 Polyclonal Antibody

Sign In for Pricing
View Details
Human AGXT2 ELISA KIT
EF004596 96 Tests

Human AGXT2 ELISA KIT

Sign In for Pricing
View Details
Myb, phosphorylated (Ser532)
402368-01 50 µL

Myb, phosphorylated (Ser532)

Sign In for Pricing
View Details
Myb, phosphorylated (Ser532)
402368-02 100 µL

Myb, phosphorylated (Ser532)

Sign In for Pricing
View Details