Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-3975 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-3975 Accession Number: MIMAT0019360 Mature Sequence: UGAGGCUAAUGCACUACUUCAC hsa-miR-3975 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-3975 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-3975 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Efhc2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6482505 3x 1.0 µg

Efhc2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

Sign In for Pricing
View Details
Ifi35 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4536904 1.0 µg DNA

Ifi35 sgRNA CRISPR Lentivector (Mouse) (Target 3)

Sign In for Pricing
View Details
Angiopoietin-2 Human Protein
DA3501X 20 µg

Angiopoietin-2 Human Protein

Sign In for Pricing
View Details
Human CENPC Knockout A549 cell line
GTR15415187 1 Vial

Human CENPC Knockout A549 cell line

Sign In for Pricing
View Details
Wnt3a Antibody (YA654)
HY-P80932 1 Each

Wnt3a Antibody (YA654)

Sign In for Pricing
View Details
Recombinant Parvovirus B19 VP1/2 Protein (aa 485-781) [His]
VAng-0625Lsx-inquire Inquire

Recombinant Parvovirus B19 VP1/2 Protein (aa 485-781) [His]

Sign In for Pricing
View Details