Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-8086 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-8086 Accession Number: MIMAT0031013 Mature Sequence: UGCUAGUCUGGACUGAUAUGGU hsa-miR-8086 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-8086 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-8086 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Human BMPR2 Protein, Fc & His Tag
KMPH2180 100 µg

Human BMPR2 Protein, Fc & His Tag

Sign In for Pricing
View Details
Fuca2 3'UTR GFP Stable Cell Line
TU156777 1.0 mL

Fuca2 3'UTR GFP Stable Cell Line

Sign In for Pricing
View Details
Lentiviral human PHF24 shRNA (UAS) - Lentiviral human PHF24 shRNA (UAS, RFP) (100)
GTR15344007 1 Vial

Lentiviral human PHF24 shRNA (UAS) - Lentiviral human PHF24 shRNA (UAS, RFP) (100)

Sign In for Pricing
View Details
Kallikrein 14 (KLK14) Human shRNA Plasmid Kit (Locus ID 43847)
TL307220 1 Kit

Kallikrein 14 (KLK14) Human shRNA Plasmid Kit (Locus ID 43847)

Sign In for Pricing
View Details
ARL8A antibody
70R-15835 50 ul

ARL8A antibody

Sign In for Pricing
View Details
SATB1 Mouse Monoclonal Antibody [Clone ID: OTI4E1]
TA500524S 30 µL

SATB1 Mouse Monoclonal Antibody [Clone ID: OTI4E1]

Sign In for Pricing
View Details