Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-301a-5p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-301a-5p Accession Number: MIMAT0022696 Mature Sequence: GCUCUGACUUUAUUGCACUACU hsa-miR-301a-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-301a-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-301a-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Hsd17b6 3'UTR GFP Stable Cell Line
TU159769 1.0 mL

Hsd17b6 3'UTR GFP Stable Cell Line

Sign In for Pricing
View Details
Goat Anti-Mouse IgG H&L Antibody
abx019221 1 mg

Goat Anti-Mouse IgG H&L Antibody

Sign In for Pricing
View Details
PSMB5 CRISPRa sgRNA lentivector (set of three targets)(Mouse)
37961124 3x 1.0µg DNA

PSMB5 CRISPRa sgRNA lentivector (set of three targets)(Mouse)

Sign In for Pricing
View Details
NBEAP4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV771710 1.0 µg DNA

NBEAP4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

Sign In for Pricing
View Details
Polyclonal antibody-Canine NADH-ubiquinone oxidoreductase chain
PA-RA-07841 100 µg

Polyclonal antibody-Canine NADH-ubiquinone oxidoreductase chain

Sign In for Pricing
View Details
Rat Prkcg ELISA Kit
ELI-19250r 96 Tests

Rat Prkcg ELISA Kit

Sign In for Pricing
View Details