Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4465 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4465 Accession Number: MIMAT0018992 Mature Sequence: CUCAAGUAGUCUGACCAGGGGA hsa-miR-4465 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4465 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4465 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Appl2 (NM_145220) Mouse Recombinant Protein
TP509855 20 µg

Appl2 (NM_145220) Mouse Recombinant Protein

Sign In for Pricing
View Details
TNF Recombinant Protein (Mouse)
OPCA04206-100UG 100 µg

TNF Recombinant Protein (Mouse)

Sign In for Pricing
View Details
OR1I1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1487605 3x 1.0 µg

OR1I1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

Sign In for Pricing
View Details
Rat Complement 4 (C4) Elisa Kit
EK720728 96 Well

Rat Complement 4 (C4) Elisa Kit

Sign In for Pricing
View Details
Prolactin (Pituitary Tumor Marker) (PRL/2643), CF488A conjugate, 0.1mg/mL
BNC882643-500 1x 500 µL

Prolactin (Pituitary Tumor Marker) (PRL/2643), CF488A conjugate, 0.1mg/mL

Sign In for Pricing
View Details
C20ORF100 Blocking Peptide
33R-9294 100 ug

C20ORF100 Blocking Peptide

Sign In for Pricing
View Details