Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4689 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4689 Accession Number: MIMAT0019778 Mature Sequence: UUGAGGAGACAUGGUGGGGGCC hsa-miR-4689 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4689 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4689 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

2-[4-[2-(1-Piperidinyl)ethoxy]benzoyl]benzoic Acid
TRC-P482095-250MG 250 mg

2-[4-[2-(1-Piperidinyl)ethoxy]benzoyl]benzoic Acid

Sign In for Pricing
View Details
Nesprin3 (SYNE3) Human Knockdown Lysate
LY300495 100 µg

Nesprin3 (SYNE3) Human Knockdown Lysate

Sign In for Pricing
View Details
Miz1 (ZBTB17) Mouse Monoclonal Antibody [Clone ID: OTI8A7]
CF811542 100 µg

Miz1 (ZBTB17) Mouse Monoclonal Antibody [Clone ID: OTI8A7]

Sign In for Pricing
View Details
Mouse Sinhcaf activation kit by CRISPRa
GA205900 1 Kit

Mouse Sinhcaf activation kit by CRISPRa

Sign In for Pricing
View Details
CD44v6 (Marker of Tumor Metastasis) (CD44V6/2496), Biotin conjugate, 0.1mg/mL
BNCB2496-100 1x 100 µL

CD44v6 (Marker of Tumor Metastasis) (CD44V6/2496), Biotin conjugate, 0.1mg/mL

Sign In for Pricing
View Details
SOD2 Polyclonal Antibody
AN006910L-01 25 µL

SOD2 Polyclonal Antibody

Sign In for Pricing
View Details