Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4744 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4744 Accession Number: MIMAT0019875 Mature Sequence: UCUAAAGACUAGACUUCGCUAUG hsa-miR-4744 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4744 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4744 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Cd300lf ORF Vector (Rat) (pORF)
15527016 1.0 µg DNA

Cd300lf ORF Vector (Rat) (pORF)

Sign In for Pricing
View Details
GABRQ Human Gene Knockout Kit (CRISPR)
KN420874 1 Kit

GABRQ Human Gene Knockout Kit (CRISPR)

Sign In for Pricing
View Details
DL-Ornithine hydrochloride
RM10641-25G 1 unit

DL-Ornithine hydrochloride

Sign In for Pricing
View Details
Chd6 (NM_173368) Mouse Tagged ORF Clone
MR224390 10 µg

Chd6 (NM_173368) Mouse Tagged ORF Clone

Sign In for Pricing
View Details
Tom1 (NM_001136259) Mouse Tagged ORF Clone Lentiviral Particle
MR217553L4V 200 µL

Tom1 (NM_001136259) Mouse Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
Human Neopterin ELISA Kit
MBS8807988-01 48 Well

Human Neopterin ELISA Kit

Sign In for Pricing
View Details