Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4301 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4301 Accession Number: MIMAT0016850 Mature Sequence: UCCCACUACUUCACUUGUGA hsa-miR-4301 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4301 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4301 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

P53AIP1 Polyclonal Antibody, HRP Conjugated
bs-7094R-HRP 100 µL

P53AIP1 Polyclonal Antibody, HRP Conjugated

Sign In for Pricing
View Details
RAB3GAP1 (NM_012233) Human Tagged Lenti ORF Clone
RC213068L4 10 µg

RAB3GAP1 (NM_012233) Human Tagged Lenti ORF Clone

Sign In for Pricing
View Details
RPS6KB2, ID (Ribosomal Protein S6 Kinase beta 2, S6K-beta-2, S6K2, 70kD Ribosomal Protein S6 Kinase 2, p70-S6K 2, P70S6K2, p70 Ribosomal S6 Kinase beta, p70 S6 Kinase beta, p70 S6K-beta, p70 S6KB, S6K-beta, p70-beta, S6 Kinase-related Kinase, SRK, Serine/Threonine-protein Kinase 14B, STK14B) (MaxLight 650) discontinued
031228-ML650 100 µL

RPS6KB2, ID (Ribosomal Protein S6 Kinase beta 2, S6K-beta-2, S6K2, 70kD Ribosomal Protein S6 Kinase 2, p70-S6K 2, P70S6K2, p70 Ribosomal S6 Kinase beta, p70 S6 Kinase beta, p70 S6K-beta, p70 S6KB, S6K-beta, p70-beta, S6 Kinase-related Kinase, SRK, Serine/Threonine-protein Kinase 14B, STK14B) (MaxLight 650) discontinued

Sign In for Pricing
View Details
Milk Fat Globulin (MFG) (PE) discontinued
M3897-08A-PE 100 µL

Milk Fat Globulin (MFG) (PE) discontinued

Sign In for Pricing
View Details
Consortin (CNST) (NM_001139459) Human Tagged ORF Clone Lentiviral Particle
RC227640L3V 200 µL

Consortin (CNST) (NM_001139459) Human Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
RPL7AP56 AAV siRNA Pooled Vector
41834161 1.0 µg

RPL7AP56 AAV siRNA Pooled Vector

Sign In for Pricing
View Details