Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-890 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-890 Accession Number: MIMAT0004912 Mature Sequence: UACUUGGAAAGGCAUCAGUUG hsa-miR-890 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-890 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-890 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Human CTSA knockdown cell line
ABC-KD3734 1 Vial

Human CTSA knockdown cell line

Sign In for Pricing
View Details
CDK5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0417507 1.0 µg DNA

CDK5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

Sign In for Pricing
View Details
Rat Sparc Pre-designed siRNA Set A
SI213584A 1 Each

Rat Sparc Pre-designed siRNA Set A

Sign In for Pricing
View Details
MED13L Human shRNA Plasmid Kit (Locus ID 23389)
TR301106 1 Kit

MED13L Human shRNA Plasmid Kit (Locus ID 23389)

Sign In for Pricing
View Details
CDC14B (Dual Specificity Protein Phosphatase CDC14B, CDC14 Cell Division Cycle 14 Homolog B, Cdc14B1, Cdc14B2, CDC14B3, hCDC14B) (MaxLight 405) discontinued
124727-ML405 100 µL

CDC14B (Dual Specificity Protein Phosphatase CDC14B, CDC14 Cell Division Cycle 14 Homolog B, Cdc14B1, Cdc14B2, CDC14B3, hCDC14B) (MaxLight 405) discontinued

Sign In for Pricing
View Details
Recombinant Rat HGF/ Hepatocyte Growth Factor Protein, GST, E.coli-50ug
QP8607-ec-50ug 50ug

Recombinant Rat HGF/ Hepatocyte Growth Factor Protein, GST, E.coli-50ug

Sign In for Pricing
View Details