Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-422a miRNA Agomir/Antagomir

MicroRNA: hsa-miR-422a Accession Number: MIMAT0001339 Mature Sequence: ACUGGACUUAGGGUCAGAAGGC hsa-miR-422a are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-422a in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-422a miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Lentiviral mouse Inpp5b shRNA (UAS) - Lentiviral mouse Inpp5b shRNA (UAS, RFP) (25)
GTR15147575 1 Vial

Lentiviral mouse Inpp5b shRNA (UAS) - Lentiviral mouse Inpp5b shRNA (UAS, RFP) (25)

Sign In for Pricing
View Details
Centrifuge tubes; Plug cap, 15mL
34117P 500 Units

Centrifuge tubes; Plug cap, 15mL

Sign In for Pricing
View Details
Anti-GPNMB Antibody (R3T41)
RHG93102 100 μg

Anti-GPNMB Antibody (R3T41)

Sign In for Pricing
View Details
TLR4 ORF Vector (Human) (pORF)
ORF014727 1.0 µg DNA

TLR4 ORF Vector (Human) (pORF)

Sign In for Pricing
View Details
Anti-CCDC74B Antibody
CTA2074-01 30 µL

Anti-CCDC74B Antibody

Sign In for Pricing
View Details
Anti-CCDC74B Antibody
CTA2074-02 50 μL

Anti-CCDC74B Antibody

Sign In for Pricing
View Details