Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-101-3p miRNA Agomir/Antagomir

MicroRNA: hsa-miR-101-3p Accession Number: MIMAT0000099 Mature Sequence: UACAGUACUGUGAUAACUGAA hsa-miR-101-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-101-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-101-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

OACA12693-50UL
OACA12693-50UL 50 µL

OACA12693-50UL

Sign In for Pricing
View Details
Rabbit Monoclonal NKX2.2 Antibody (NX2/2198R)
NBP3-07410-20ug 20 µg

Rabbit Monoclonal NKX2.2 Antibody (NX2/2198R)

Sign In for Pricing
View Details
5-Chloro-4- (2,4-dichlorophenyl) -1,2,3-thiadiazole
sc-318581 500 mg

5-Chloro-4- (2,4-dichlorophenyl) -1,2,3-thiadiazole

Sign In for Pricing
View Details
Rabbit Polyclonal EIF3C Antibody
NBP2-14945 0.1 mL

Rabbit Polyclonal EIF3C Antibody

Sign In for Pricing
View Details
CD81 (1.3.3.22)
sc-7637 200 µg/mL

CD81 (1.3.3.22)

Sign In for Pricing
View Details
WFDC5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2637705 3x 1.0 µg

WFDC5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

Sign In for Pricing
View Details