Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-8079 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-8079 Accession Number: MIMAT0031006 Mature Sequence: CAGUGAUCGUCUCUGCUGGC hsa-miR-8079 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-8079 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-8079 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Lentiviral human CORO1A shRNA (UAS) - Lentiviral human CORO1A shRNA (UAS, GFP) plasmid
GTR15354025 1 Vial

Lentiviral human CORO1A shRNA (UAS) - Lentiviral human CORO1A shRNA (UAS, GFP) plasmid

Sign In for Pricing
View Details
Lentiviral mouse Psd shRNA (UAS) - Lentiviral mouse Psd shRNA (UAS) plasmid
GTR15176191 1 Vial

Lentiviral mouse Psd shRNA (UAS) - Lentiviral mouse Psd shRNA (UAS) plasmid

Sign In for Pricing
View Details
ERPL2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV760798 1.0 µg DNA

ERPL2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

Sign In for Pricing
View Details
S100A9 sgRNA CRISPR Lentivector set (Human)
K0008601 3x 1.0 µg

S100A9 sgRNA CRISPR Lentivector set (Human)

Sign In for Pricing
View Details
INPP5E Rabbit pAb
MBS9142977-01 0.02 mL

INPP5E Rabbit pAb

Sign In for Pricing
View Details
INPP5E Rabbit pAb
MBS9142977-02 0.1 mL

INPP5E Rabbit pAb

Sign In for Pricing
View Details