Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-8079 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-8079 Accession Number: MIMAT0031006 Mature Sequence: CAGUGAUCGUCUCUGCUGGC hsa-miR-8079 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-8079 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-8079 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

NR2C2 Rabbit Polyclonal Antibody
TA346489 100 µL

NR2C2 Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
ZNF454 (NM_182594) Human Over-expression Lysate
LC405474 20 µg

ZNF454 (NM_182594) Human Over-expression Lysate

Sign In for Pricing
View Details
FLJ23834 (Hypothetical Protein FLJ23834, FLJ43271, MGC133292, MGC133293) (HRP)
246193-HRP 100 µL

FLJ23834 (Hypothetical Protein FLJ23834, FLJ43271, MGC133292, MGC133293) (HRP)

Sign In for Pricing
View Details
Human Herpes simplex virus 1 (HSV-Ag1) ELISA Kit
GA-E1122HM-01 48 Tests

Human Herpes simplex virus 1 (HSV-Ag1) ELISA Kit

Sign In for Pricing
View Details
Human Herpes simplex virus 1 (HSV-Ag1) ELISA Kit
GA-E1122HM-02 96 Tests

Human Herpes simplex virus 1 (HSV-Ag1) ELISA Kit

Sign In for Pricing
View Details
GREM1 (Gremlin 1) BioAssayTM ELISA Kit (Rat) discontinued
356101-01 48 Tests

GREM1 (Gremlin 1) BioAssayTM ELISA Kit (Rat) discontinued

Sign In for Pricing
View Details