Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-1197 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-1197 Accession Number: MIMAT0005955 Mature Sequence: UAGGACACAUGGUCUACUUCU hsa-miR-1197 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-1197 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-1197 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rnf186 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3672405 3x 1.0 µg

Rnf186 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

Sign In for Pricing
View Details
Anti-GADD45G Antibody Picoband® (Dylight594 Conjugate)
A04681-1-Dylight594 100 µg

Anti-GADD45G Antibody Picoband® (Dylight594 Conjugate)

Sign In for Pricing
View Details
Ptprsa Polyclonal Antibody
CAC15684-01 50 µg

Ptprsa Polyclonal Antibody

Sign In for Pricing
View Details
Ptprsa Polyclonal Antibody
CAC15684-02 100 µg

Ptprsa Polyclonal Antibody

Sign In for Pricing
View Details
Gm5151 Lentiviral Vector (Mouse) (CMV) (pLenti-GIII-CMV)
22082064 1.0 µg DNA

Gm5151 Lentiviral Vector (Mouse) (CMV) (pLenti-GIII-CMV)

Sign In for Pricing
View Details
RANTES Polyclonal Antibody, HRP Conjugated
bs-1324R-HRP-TR 20 µL

RANTES Polyclonal Antibody, HRP Conjugated

Sign In for Pricing
View Details