Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-892a miRNA Agomir/Antagomir

MicroRNA: hsa-miR-892a Accession Number: MIMAT0004907 Mature Sequence: CACUGUGUCCUUUCUGCGUAG hsa-miR-892a are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-892a in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-892a miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

CHD2 Rabbit pAb
E45R26193N 50 ul

CHD2 Rabbit pAb

Sign In for Pricing
View Details
CHD1L Rabbit Polyclonal Antibody (BF488)
orb2475401 100 µL

CHD1L Rabbit Polyclonal Antibody (BF488)

Sign In for Pricing
View Details
ZP1 Antibody
35166-01 50 µL

ZP1 Antibody

Sign In for Pricing
View Details
ZP1 Antibody
35166-02 100 µL

ZP1 Antibody

Sign In for Pricing
View Details
SLC44A4 (NM_025257) Human Tagged ORF Clone Lentiviral Particle
RC217264L3V 200 µL

SLC44A4 (NM_025257) Human Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
Ifitm1 AAV siRNA Pooled Vector
24232166 1.0 µg

Ifitm1 AAV siRNA Pooled Vector

Sign In for Pricing
View Details