Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-638 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-638 Accession Number: MIMAT0003308 Mature Sequence: AGGGAUCGCGGGCGGGUGGCGGCCU hsa-miR-638 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-638 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-638 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Recombinant Human FGF10/ KGF2 Protein Protein, His-SUMO, E.coli-1mg
QP6039-ec-1mg 1mg

Recombinant Human FGF10/ KGF2 Protein Protein, His-SUMO, E.coli-1mg

Sign In for Pricing
View Details
Gm10731 Mouse shRNA Lentiviral Particle (Locus ID 100039043)
TL518808V 500 µL Each

Gm10731 Mouse shRNA Lentiviral Particle (Locus ID 100039043)

Sign In for Pricing
View Details
Human SNRPEP2 qPCR Primer Pair
QH78305S 200 Tests

Human SNRPEP2 qPCR Primer Pair

Sign In for Pricing
View Details
Anti-LSM12 Antibody
MBS8307186-01 0.03 mL

Anti-LSM12 Antibody

Sign In for Pricing
View Details
Anti-LSM12 Antibody
MBS8307186-02 0.05 mL

Anti-LSM12 Antibody

Sign In for Pricing
View Details
Anti-LSM12 Antibody
MBS8307186-03 0.1 mL

Anti-LSM12 Antibody

Sign In for Pricing
View Details