Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-638 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-638 Accession Number: MIMAT0003308 Mature Sequence: AGGGAUCGCGGGCGGGUGGCGGCCU hsa-miR-638 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-638 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-638 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Mouse Monoclonal TSLPR/CRLF2 Antibody (147036) [Biotin]
FAB981B 0.5 mL

Mouse Monoclonal TSLPR/CRLF2 Antibody (147036) [Biotin]

Sign In for Pricing
View Details
Thyroglobulin (TG) Mouse Monoclonal Antibody (Biotin conjugated) [Clone ID: OTI15E11]
TA804620AM 100 µL

Thyroglobulin (TG) Mouse Monoclonal Antibody (Biotin conjugated) [Clone ID: OTI15E11]

Sign In for Pricing
View Details
Tmx2 (NM_025868) Mouse Recombinant Protein
PM44158M5 20 µg

Tmx2 (NM_025868) Mouse Recombinant Protein

Sign In for Pricing
View Details
Rabbit Polyclonal BRAF35 Antibody
NBP2-58321-25ul 25 µL

Rabbit Polyclonal BRAF35 Antibody

Sign In for Pricing
View Details
BI-894999
MBS3602534-01 5 mg

BI-894999

Sign In for Pricing
View Details
BI-894999
MBS3602534-02 10 mg

BI-894999

Sign In for Pricing
View Details