Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-8075 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-8075 Accession Number: MIMAT0031002 Mature Sequence: UGCUGAUGGCAGAUGUCGGGUCUG hsa-miR-8075 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-8075 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-8075 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

AADAT Antibody
A11485-100UL 100 µL

AADAT Antibody

Ask
View Details
Etfb (NM_001004220) Rat Tagged Lenti ORF Clone
RR209202L3 10 µg

Etfb (NM_001004220) Rat Tagged Lenti ORF Clone

Ask
View Details
Lentiviral human SLC39A4 shRNA (UAS) - Lentiviral human SLC39A4 shRNA (UAS, iRFP) (100)
GTR15080619 1 Vial

Lentiviral human SLC39A4 shRNA (UAS) - Lentiviral human SLC39A4 shRNA (UAS, iRFP) (100)

Ask
View Details
SSX2 (Synovial Sarcoma X Breakpoint 2, Protein SSX2)
492911 100 µL

SSX2 (Synovial Sarcoma X Breakpoint 2, Protein SSX2)

Ask
View Details