Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-8075 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-8075 Accession Number: MIMAT0031002 Mature Sequence: UGCUGAUGGCAGAUGUCGGGUCUG hsa-miR-8075 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-8075 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-8075 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

C21orf70 Polyclonal Antibody, AbBy Fluor™ 750 Conjugated
bs-9979R-BF750 100 µL

C21orf70 Polyclonal Antibody, AbBy Fluor™ 750 Conjugated

Ask
View Details
PYY protein
MBS5303692-01 0.1 mg

PYY protein

Ask
View Details
PYY protein
MBS5303692-02 5x 0.1 mg

PYY protein

Ask
View Details
Coro1b Mouse Gene Knockout Kit (CRISPR)
KN503703 1 Kit

Coro1b Mouse Gene Knockout Kit (CRISPR)

Ask
View Details
Human Oct-4A MAb (Clone 653108)
MAB17591 100 µg

Human Oct-4A MAb (Clone 653108)

Ask
View Details
Interleukin 2 Receptor (IL-2R) (MaxLight 490)
MBS6198954-01 0.1 mL

Interleukin 2 Receptor (IL-2R) (MaxLight 490)

Ask
View Details