Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ hsa-miR-4794 miRNA Agomir/Antagomir

MicroRNA: hsa-miR-4794 Accession Number: MIMAT0019967 Mature Sequence: UCUGGCUAUCUCACGAGACUGU hsa-miR-4794 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about hsa-miR-4794 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose hsa-miR-4794 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Porcine Adrenomedullin (ADM) ELISA Kit
RDR-ADM-p-96Tests 96 Tests

Porcine Adrenomedullin (ADM) ELISA Kit

Sign In for Pricing
View Details
Galanthus nivalis Gel -GNA- Immobilized Lectin
A-7401-2 2 mL

Galanthus nivalis Gel -GNA- Immobilized Lectin

Sign In for Pricing
View Details
Rabbit Monoclonal 4-1BB/TNFRSF9/CD137 Antibody (2356B) [Janelia Fluor 669]
FAB8381JF669 0.1 mL

Rabbit Monoclonal 4-1BB/TNFRSF9/CD137 Antibody (2356B) [Janelia Fluor 669]

Sign In for Pricing
View Details
LY-3475070
207152 100.0mg

LY-3475070

Sign In for Pricing
View Details
Tesp1 Recombinant Protein (Rat)
RP232802 100 µg

Tesp1 Recombinant Protein (Rat)

Sign In for Pricing
View Details
SLC25A14 (Brain Mitochondrial Carrier Protein 1, BMCP-1, Mitochondrial Uncoupling Protein 5, UCP 5, Solute Carrier Family 25 Member 14, BMCP1, UCP5, UNQ791/PRO1682, MGC149543) (AP)
MBS6402528-01 0.1 mL

SLC25A14 (Brain Mitochondrial Carrier Protein 1, BMCP-1, Mitochondrial Uncoupling Protein 5, UCP 5, Solute Carrier Family 25 Member 14, BMCP1, UCP5, UNQ791/PRO1682, MGC149543) (AP)

Sign In for Pricing
View Details